Essays /

141009 Paper Presentation Essay

Essay preview

Reliable Single Cell Array CGH for Clinical Samples
Zbigniew T. Czyz_1,2, Martin Hoffmann2, Gu¨nter Schlimok3, Bernhard Polzer2, Christoph A. Klein1,2* 1 Experimental Medicine and Therapy Research, University of Regensburg, Regensburg, Germany, 2 Project Group Personalized Tumor Therapy, Fraunhofer Institute for Toxicology and Experimental Medicine ITEM, Regensburg, Germany, 3 Hospital Augsburg, II. Medical Center, Augsburg, Germany

Abstract
Background: Disseminated cancer cells (DCCs) and circulating tumor cells (CTCs) are extremely rare, but comprise the precursors cells of distant metastases or therapy resistant cells. The detailed molecular analysis of these cells may help to identify key events of cancer cell dissemination, metastatic colony formation and systemic therapy escape. Methodology/Principal Findings: Using the Ampli1TM whole genome amplification (WGA) technology and high-resolution oligonucleotide aCGH microarrays we optimized conditions for the analysis of structural copy number changes. The protocol presented here enables reliable detection of numerical genomic alterations as small as 0.1 Mb in a single cell. Analysis of single cells from well-characterized cell lines and single normal cells confirmed the stringent quantitative nature of the amplification and hybridization protocol. Importantly, fixation and staining procedures used to detect DCCs showed no significant impact on the outcome of the analysis, proving the clinical usability of our method. In a proof-of-principle study we tracked the chromosomal changes of single DCCs over a full course of high-dose chemotherapy treatment by isolating and analyzing DCCs of an individual breast cancer patient at four different time points. Conclusions/Significance: The protocol enables detailed genome analysis of DCCs and thereby assessment of the clonal evolution during the natural course of the disease and under selection pressures. The results from an exemplary patient provide evidence that DCCs surviving selective therapeutic conditions may be recruited from a pool of genomically less advanced cells, which display a stable subset of specific genomic alterations. Citation: Czyz_ ZT, Hoffmann M, Schlimok G, Polzer B, Klein CA (2014) Reliable Single Cell Array CGH for Clinical Samples. PLoS ONE 9(1): e85907. doi:10.1371/ journal.pone.0085907

Editor: Anthony W.I. Lo, The Chinese University of Hong Kong, Hong Kong Received August 30, 2013; Accepted December 7, 2013; Published January 21, 2014 Copyright: ß 2014 Czyz_ et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This study was funded by The German Cancer Aid (Deutsche Krebshilfe): grant number 109753. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected]

reasons, detailed analysis of DCCs and CTCs may help to identify genes and pathways allowing cancer cells to leave the primary lesion, survive in the circulation for extended periods of time, colonize distant sites, and survive systemic therapies.

A variety of analytical techniques have been developed to
amplify and study the genomes of single-cells [15–23]. Chromosomal comparative genomic hybridization (cCGH) could be adapted to analyze single-cell DNA and identify highly penetrant alterations in the genomes of DCCs [19]. This method, although comprehensive, is very labor-intensive and allows only detection of aberrant regions larger than 10–20 Mb. Implementation of array CGH (aCGH) technology revolutionized the study of single-cell cancer genomes. A single-cell aCGH assay using tiling path BAC array platform described by Fiegler et al. allowed detection of a deletion of 8.3 Mb [24]. Using arrays composed of highly purified BAC clones previously we identified aberrant regions as small as 1–2 Mb in cell lines and 4.8 Mb in DCCs [25]. More recent

studies indicate that using high-density oligonucleotide microarrays the detection limit of single-cell aCGH can be reduced to 1 Mb or less in freshly isolated cells [26,27]. Despite these advances an additional hurdle consists in the requirements

imposed by clinical samples. So far, it has not been extensively studied how fixation and staining methods used to identify CTCs and DCCs may influence the outcome of the single-cell aCGH.

Introduction
Comprehensive analysis of minute quantities of genomic DNA
has become important in a variety of forensic, diagnostic and biological studies. For example, in cancer research or preimplantation diagnostics, the number of available cells for downstream analyses may be as low as one single cell. In cancer research, single-cell technologies are increasingly needed to study the course of metastatic spread of cancer cells. Multiple studies conducted in the past have shown that the presence of circulating tumor cells (CTCs) in the peripheral blood or disseminated cancer cells (DCCs) in the bone marrow (BM) or lymph nodes (LN) is an independent prognostic factor of poor outcome of almost all tested cancer types [1–5]. Strikingly, it could be shown that cancer cells disseminate very early during the course of disease and evolve in parallel to the tumor cells at the primary site [6–8]. These findings were supported by significant genetic disparity observed between the primary tumors (PTs) and corresponding DCCs [9–11] as well as among DCCs themselves [12]. Subsequent functional studies demonstrated that, at least in the case of esophageal cancer, DCCs show different susceptibility to applied anti-cancer treatment than cancer cells originating from the primary lesion [11]. In line with this, studies in breast cancer have shown that DCCs and CTCs may survive the first line treatment indicating their intrinsic or acquired resistance to cancer therapy [13,14]. For all of these PLOS ONE | www.plosone.org

1

January 2014 | Volume 9 | Issue 1 | e85907

Single-Cell Array CGH for Clinical Samples

The objective here was to establish a robust single-cell aCGH protocol allowing reliable detection of genomic alterations in patient-derived DCCs. We applied Ampli1TM single-cell WGA
technology together with SuperPrint G3 46180 k Agilent aCGH
microarrays to provide a precise and easy to use workflow for highresolution assessment of copy number changes in single cells. We show that the new workflow displays high specificity and enables reliable assessment of the copy number changes in single DCCs, which may be used to address the cellular heterogeneity in cancer. Finally, we demonstrate the potential of our new technique in a case study of DCCs isolated from a patient with advanced breast cancer disease during the course of high-dose chemotherapy

treatment.

Re-amplification of the WGA products

Materials and Methods

Re-amplification was performed in a volume of 50 ml. Each
PCR reaction was composed of the following ingredients: 5 ml Expand Long Template Buffer 1 (Roche Diagnostic), 1 mM of the LIB1 (59-TAGTGGGATTCCTGCTGTCAGT-39) or MseLig-21
primer (59-AGTGGGATTCCTGCTGTCAGT-39) – depending
on the adapter used in the primary WGA, 1.75 ml dNTPs
(10 mM), 1.25 ml BSA (Roche Diagnostic), 2.5 U of ExpandLong-Template DNA Polymerase (Roche Diagnostic) and 1.0 ml of the template DNA. The MJ thermocycler was set as follows: 1 cycle of 94uC for 60 sec, 60uC for 30 sec, 65uC for 2 min, 10 cycles of 94uC for 30 sec, 60uC for 30 sec, 65uC for 2 min (extended by 20 sec/cycle). Typically three reactions were run in parallel, which were pooled and used as template for DNA labeling and aCGH. A negative control was included in every run.

Ethics statement

Labeling of sample DNA

Bone marrow sampling was performed within the study
protocol of the GEBDIS study at the Central Hospital in
Augsburg after informed written consent of patients was obtained. The ethics committees of the University of Tu¨bingen and of the University of Regensburg (ethics vote number 07-079) approved bone marrow sampling and genomic analysis of the isolated cells. Additionally, as control and reference samples, we used single cells from the mononuclear cell fraction of peripheral blood obtained from five healthy donors. Three donors provided written informed consent after obtaining approval by the ethics committee of the University of Regensburg (ethics vote number 12-101-0038) and two healthy donors provided verbal informed consent. The latter samples were taken before 2008 when no ethics vote for voluntary blood donations of healthy donors was required.

Random-primed DNA labeling approach (RP labeling). Test and reference DNA samples were labeled using SureTag DNA Labeling Kit (Agilent Technologies) according to the instruction provided by the supplier (Agilent Oligonucleotide Array-Based CGH for Genomic DNA Analysis, version 7.1,

December 2011). Briefly, 1.5 – 2.0 mg of the purified input DNA (WGA product or unamplified genomic DNA) was supplemented
with 5 ml of Random Primer Mix and filled up with H2O to 31 ml. Unamplified DNA and WGA products samples were denatured at
95uC for 10 or 3 minutes, respectively. Sample tubes were
transferred on ice and incubated for 5 min. The labeling reaction with exo-Klenow fragment consisted of the following ingredients: 31 ml of denatured DNA, 10 ml of 5x Reaction Buffer, 5.0 ml of 10x dNTP Mix, 3.0 ml of Cy5-dUTP (test) or Cy3-dUTP

(reference) and 1.0 ml of Exo(–) Klenow fragment. Labeling reaction was run at 37uC for two hours, followed by an
inactivation step at 65uC for 10 minutes. Labeled DNA was
purified using Ultra 0.5 purification system with a size cut-off of 30 kDa. DNA yields and dye incorporation rates were quantified using the NanoDrop ND-1000 instrument.
PCR-based labeling. PCR-based labeling using dye-conjugated
universal primer (PCR-T1). Placement of the dye on the universal primer provides the advantage that all restriction digestion fragments present in the WGA product irrespectively of their size will be labeled with the same amount of dye. To avoid crosshybridization of adapter sequences flanking amplicons in the WGA products, test and reference samples were labeled using

different PCR-adapters. Test samples were labeled with the PCRadapter incorporated in the Ampli1TM WGA kit, while all the reference DNA samples were amplified using the following
adapters: MIB5 (59-TGAGCTGGTCATTGCGCATGGT-39)
and ddMse XI (59-TAACCATGCGC-39). Universal primers used
in the labeling reaction were directly conjugated with either Cy5 in the case of Ampli1TM universal primer [59-TAGTGGGATTCCTGCTGTCAGT-39] or Cy3 in the cases of MIB5 primer [59-TGAGCTGGTCATTGCGCATGGT-39] (underscores indicate the placement of the dye). The labeling PCR was run in a total volume of 50 ml reaction composed of 5 ml of 10x Expanded Long Template Buffer 1 (Roche Diagnostics), 2.4 mM

of dye-conjugated LIB1 or MIB5 primer (for test and reference sample, respectively), 350 mM of dNTPs, 0.5 ml BSA (Roche), 3.75 U of Expand-Long-Template DNA Polymerase (Roche Diagnostics) and 1.0 ml of the template DNA. The PCR was programmed as follows: 10 cycle of 94uC for 15 sec, 51uC for 30 sec and 65uC for 3:30 min, 2 cycles of 94uC for 15 ...

Read more

Keywords

-0038 -079 -1000 -101 -1590 -19 -2 -21 -3 -39 -4 -474 -6 /journal.pone.0085907.g001 /journal.pone.0085907.g002 /journal.pone.0085907.g003 /journal.pone.0085907.g004 /journal.pone.0085907.g005 /reference /test 0 0.1 0.25 0.3 0.5 0.94 0.97 0085907 022060 07 1 1.0 1.06106 1.25 1.5 1.75 10 10.1371 10.7 100 1066 107 1075 109753 10x 11 12 121 123 13 131 14 141009 1420 1430 15 1500 159 16 1622 1626 1627 1630 166 17 177 17q 18 183 19 1965 1970 1991 1992 1998 1999 2 2.0 2.15 2.4 2.5 20 200 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2017 2021 21 22 227 23 239 24 25 26 26106 27 28 281 29 294 2967 2976 2a 2a-b 2c 2c-d 2x 3 3.0 3.60 3.75 30 302 307 31 310 312 315 32 3213 3221 329 33 337 338 34 342 3457 3464 35 350 36 360 361 365 369 37 372 377 37uc 38 39 3940 3945 3b 4 4.42 4.8 40 4000 41 415 42 43 44 441 4494 4499 45 453 46 46180 46180k 47 48 481 49 4a 5 5.0 5.6 5.79 50 500 501 506 50ml 510 51uc 525 533 557 5701 5710 572 577 58 583 5847 5851 59 5a 5b 5c 5d 5e 5x 6 6.0 6.5 60 60uc 618 624 64 65uc 67 68 683 6836 6840 689 7 7.1 7.5 710692 739 747 75 7737 7742 8 8.3 841 847 885 89 892 8q 9 92 94 94uc 95uc 96 97 98 a-d a45b/b3 ab aberr abil absolut abstract abu abu-amero ac acad accept access accompani accord accur accuraci acetonitril acgh acgh/chip-on-chip achiev acid acknowledg acquir across acut adapt addit address adm adm2 administ adult adv advanc advantag affect affin afford agglomer agil agtgggattcctgctgtcagt ahr aid akoum al albertson algorithm alkalin allow almost alreadi also alter although american amero amicon aml among amount amp ampli1tm amplicon amplif amplifi analys analysi analyt analyz aneuploid aneuploidi ann anthoni anti anti-canc antibodi appear appli applic approach approv ar archiv area arneson array array-bas array-cgh array-compar arrow arrowhead articl artifact artifici ask aspir assay assay.a assess assist associ asterisk atcc attribut auc auer augsburg august austria author autochthon autolog avail averag avoid await axi azouri b b-c bac bac-bas bachelot background balanc baner bartenhagen base basi bcip/nbt becam becom behren benchmark bernhard best better bezler bh bi bias bin binar binari bind bingen biol biolog biom biostatist biosystem black blankenstein blastocyst blastomer block blood blue bm bone bp br bracket brain braun braunschweig bray bray-ward breast breit breman brewer briefli bromo bsa bt bt474 budd buffer bulk bundo c ca caignec cak calcul call cancer cao capabl carboplatin carey carri carrier case cbs ccgh cdkn2a cell cell-pool cell-to-cel cellular census center central cep17 cgh ch challeng chang chapman character characterist chemotherapeut chemotherapi cheng chines chloro choic christoph [email protected] chromosom cinnioglu circl circul circular citat cj ck2 cleav cleavag cleavage-stag clin clinic clonal clone close cluster cnas code coeffici cohen coin coll colleagu collect colon coloni colony-stimul colorect combin committe common compar comparison compart compat compet complet compos comprehens compris comput conceiv concept conclus conclusions/significance concord condit conduct confirm conjug consent consequ consid consist constitut contrast contribut control cooper copi copy-numb copyright core correct correl correspond cot1 cot1-dna could count cours coverag creativ credit cristofanilli cross cross-hybrid crosshybrid cs csf ctcs cui cultur current curv custom customiz cut cut-off cy cy3 cy3-dctp cy3-dutp cy3-green cy5 cy5-dutp cy5-red cy5/cy3-dutp cycl cycler cyclophosphamid cytogenet cytokeratin cytokeratin-posit czyz d dako daskalaki data databas date datp dc dcc dccs dctp ddmse de decemb decis declar decreas dedic defin delalog delet demonstr denatur densiti depend depict deposit deriv describ design despit detail detect determin deutsch develop devolut df dg dgtp diagn diagnos diagnosi diagnost diagram dietmaier differ digest ding direct discret discuss diseas dispar displac display dissemin distanc distant distribut distributor diverg dlrs dna dntp dntps docx doi donat done donor dose downstream doxorubicin ds dsmz dttp due dutp dutter dye dye-conjug dynam e e-mail e105 e1306 e15 e39 e405 e67031 e68 e85907 earli early-stag easi editor effect eight either el el-akoum elli elong elsewher em embed embryo employ enabl end endonucleas engl environ eppendorf equal er erbb2 erbb2/cep17 es escap esophag essenti establish et ethic eu euclidean euclidian european evalu even event everi evid evolut evolv exampl exclus execut exemplari exist exo exo-klenow expand expand-long-templ expandlong expandlong-templ experi experiment express extend extens extract extrem f factor fals fan far favor fd feasibl featur fehm femal fertil fewer ffpe fiber fidel fiegler figur file fill filter final find fingerprint first first-lin fish fit five fix fixat fjelldal flank fluctuat fluoresc focus follow forens form formalin formalin-fix format found foundat founder four fraction fragment fragouli fraunhof free fresh fuhrmann full function fund funder futreal g g-csf g3 gain gambin gangnus gave gdna ge gebauer gebdi geigl gemelo gene generat genet genom genome-wid geo german germani ghazani give grant granulocyt granzow graphic green group gs gse52366 gt gu h h2o hajag hamann hamburg hamburg-eppendorf harbor hartmann haut hay healthcar healthi hellani help henc hepp her2 heterogen heterozygos hi hierarch high high-dens high-dos high-level high-qual high-resolut higher highest highresolut highthroughput hoffmann hoffmann2 homogen homozyg hong honisch horizont hosch hospit hour howev huang hubbard hubert hum human hundr hurdl husemann hybrid hyperbranch i.e iakovlev iannotti ice ident identif identifi igep igg1 ii iii imag imbal immers immunocytochem immunostain impact implement implic import impos improv inactiv includ incorpor increas incub inde independ indic individu indolyl influenc inform ing ingredi input inspect instabl institut instruct instrument int intens interest intermedi interphas interv intrins introduc introduct irrespect isofamid isol isotherm isotyp isrn issu item iv iwamoto izbicki j ja jackmaert jaff janni januari jb jh jm johnson journal.pone jr juli jy k kappa karyotyp katz katz-jaff kb kd kda keller key kit kittler klein klein1 klenow known koboldt kone kong kraus krebshilf l label labor labor-intens lacey lack lage lam lancet langer languag larg larger larson last latent latter le lead leamon least leav left leibniz leigh lesion less leukaemia leukemia level levi ley li lib1 licens liestol like limit line ling linkag lite littl lizardi ln lo locat loci locus log2 long loss low lower lu lucito lymph m magnifi mail maintain major male malign manufactur manuscript marker marrow marshal martin mask mass match materi materials/analysis mathiesen may mb mda mda-mb measur med median medic medicin medium meiotic meta meta-analysi metastas metastasi metastat method methodology/principal meyer mg mg/m2 mh mib5 microarray microdelet microdissect microdupl micromanipul micrometastat microorgan middl miller min minim minimum minor minut mismatch mix mj ml mm model modif mohlendick mol molecular monitor monoclon mononuclear mopc moreno moreov mous mr mra mras mselig mtdh muller multipl munn musiani mutat mv myc myelodysplast myelogen myeloid n n1bii nakano nanodrop nat natl natur navidi nd need negat never new newli next ngs ngs-base nh nine nitroblu node nois non normal note notic novel nr nter nuclei nucleic nucleotid number numer o obenauf object observ obtain occult occur oe offer old oligo oligonucleotid oligonucleotide-bas olshen omnibus oncogen oncol one onlin open open-access oper optim option origin other otherwis ouillett outcom outgrowth overal overexpress overlap overt overview p pa pair panel pantel paper paraffin paraffinembed parallel parkin past path patholog pathway patient patient-deriv pattern pbscs pcr pcr-adapt pcr-base pcr-t1 pcr-t2 pcradapt pcrt2 pearson pejov penetr perform period peripher permit persist person petat petat-dutt petronio pgs pgs-aneuploidi phosphat phosphatas phosphatase/anti-alkaline pick pierga pinkel pl place placement platform plos plot pm pm1 point polymeras polymorph polzer polzer2 pool poor popul porter posit possibl potenti pr practic precis preclin precursor predict pregnanc preimplant prenat prepar presenc present pressur previous primari prime primer principl prior privat probe proc procedur process product prof profil prognost program progress progression-fre project prolif proof proof-of-principl prospect prostat protoc protocol prove provid pt pt1590 pt4b pts publish punt purif purifi purpos qua qualit qualiti quantifi quantit quantiti r r80 raba ragg random random-prim rare rate ratio ration rational rb1 re re-amplif re-amplifi reach reaction reagent reason receiv recent reciproc recogn recognit recombin recommend recruit recurr red reduc refer reflect regensburg regim region relaps relat relationship relev reliabl remain remark remov repeat replic report repositori repres represent reprod reproduc reproduct requir res research resect residu resist resolut respect respons restrict result rev reveal review revolution riethdorf right rigler risk robertsonian robust roc roc-analysi roc-curv roccurv roch role roll room round routin row rp rp-label rpm rr rt run rxi ryan ryck s1 s1-s3 s1a s1a-c s1d s1s3 s2 s3 s3a s3a-b s3c s4 s5 s6 s7 s8 sabbath saidman sampl santarius sb scan scanner schardt scheunemann schlimok schlimok3 schmidt schmidt-kittl schmitt schneider schoolcraft schubert sci scienc scott screen search sec sec/cycle second secondari segment select sensit separ sequenc sermon serum set set-up sex share shaw shipley short short-term show shown signal signal-to-nois signific silicon similar sinc sine singl single-cel singlecel singlenucleotid sister site size sj sk sk-br skbr3 slide slight small smallest snp softwar sought sourc space specif specimen speicher sperm spit spread stabil stabl staff stage stain standard stankiewicz start statement statist steadili steirteghem stem step steril stern still stimul stoecklein stopeck strand strategi stratton strike stringent structur studi su subclon subject subsequ subset substanti substrat success suffici suggest suit suitabl summari superprint supplement supplier support suppressor sureprint suretag surpris survey surviv suscept sweep syndrom synnestvedt system systemat t1 t2 taaccatgcgc tabl tagtgggattcctgctgtcagt taken tao target taxotereh tazon tazon-vega team technic techniqu technolog temperatur templat term test tetrazolium text tgagctggtcattgcgcatggt thank therapeut therapi therebi therefor thermocycl thienpont thiotepa third thr three threshold throughout thus tif tiff tile time tissu tj togeth tool total toxicolog trace track transfer transloc transplant traversa treat treatment treff trial tru1i true true-posit tu tube tumor tumour tween20 twice two type typic u ueda ukai ultra unamplifi unbias uncov underscor uniqu unit uniti univers unrestrict unspecif upon upper url us usabl usag use util v v/v v9 valid valu van vannest variabl variant variat varieti various vay vega venkatraman venn vepesid verbal verbek vermeesch version vertic viabl vienna vimentin visual voet vogl volum voluntari vote vs w w.i waldispuehl waldispuehl-geigl wang ward warren wash wbcs week well well-character wga wherea whether white whole whole-genom wide wiedswang wigler wikman within wolfgang workbench workflow would written wrote wu www.plosone.org www.r-project.org x x-axi xb xh xi xie xs y y-axi yang year yellow yield zbigniew zero zhang zhong zhuang zong zt ztc ß